Sequence retrieval

Genome: Corynebacterium diphtheriae VA01
Start position: 2016961
End position: 2016990
Length: 30

DNA sequence
>NC_016790, from 2016961 to 2016990 (30 bp); Corynebacterium diphtheriae VA01 TCGCCCACCAGCGCCCACCAGCGCCCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2016881-2017024	Sequence	CDVA01_1877 - hypothetical protein (Protein is coded in complementary strand; from 2017024 to 2016881)