Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1379175
End position: 1379198
Length: 24

DNA sequence
>NC_016804, from 1379175 to 1379198 (24 bp); Mycobacterium bovis BCG str. Mexico GGCGCTGGCGGTGACGCTGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1378928-1379851	Sequence	BCGMEX_1268 sugA putative sugar-transport integral membrane protein ABC transporter