Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1480015
End position: 1480038
Length: 24

DNA sequence
>NC_016804, from 1480015 to 1480038 (24 bp); Mycobacterium bovis BCG str. Mexico TCGCGTACGCGTTCGCGCTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1479307-1481010	Sequence	BCGMEX_1353c - putative adenylate cyclase (Protein is coded in complementary strand; from 1481010 to 1479307)