Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1651019
End position: 1651042
Length: 24

DNA sequence
>NC_016804, from 1651019 to 1651042 (24 bp); Mycobacterium bovis BCG str. Mexico GGCGCCGGCCCCGCCGCCGTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1650960-1652072	Sequence	BCGMEX_1501c PE_PGRS29 PE-PGRS family protein (Protein is coded in complementary strand; from 1652072 to 1650960)