Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1839386
End position: 1839409
Length: 24

DNA sequence
>NC_016804, from 1839386 to 1839409 (24 bp); Mycobacterium bovis BCG str. Mexico GCCGCCGCTGCCGCCGGCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1837872-1840928	Sequence	BCGMEX_1662c PE_PGRS30 PE-PGRS family protein (Protein is coded in complementary strand; from 1840928 to 1837872)