Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2373876
End position: 2373899
Length: 24

DNA sequence
>NC_016804, from 2373876 to 2373899 (24 bp); Mycobacterium bovis BCG str. Mexico CCGGCACCAGCACCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2372723-2374297	Sequence	BCGMEX_2158c ftsW cell division protein FtsW (Protein is coded in complementary strand; from 2374297 to 2372723)