Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2712131
End position: 2712154
Length: 24

DNA sequence
>NC_016804, from 2712131 to 2712154 (24 bp); Mycobacterium bovis BCG str. Mexico GACCGGCGCACCGGCGAACCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2711394-2712200	Sequence	BCGMEX_2474c - DNA glycosylase (Protein is coded in complementary strand; from 2712200 to 2711394)