Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2748460
End position: 2748483
Length: 24

DNA sequence
>NC_016804, from 2748460 to 2748483 (24 bp); Mycobacterium bovis BCG str. Mexico CACCGCCAACGCCACCGGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2747970-2749397	Sequence	BCGMEX_2501c PE_PGRS43a PE-PGRS family protein (Protein is coded in complementary strand; from 2749397 to 2747970)