Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2846782
End position: 2846805
Length: 24

DNA sequence
>NC_016804, from 2846782 to 2846805 (24 bp); Mycobacterium bovis BCG str. Mexico CGACACCGCCACCGACACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2846321-2847343	Sequence	BCGMEX_2594c - hypothetical protein (Protein is coded in complementary strand; from 2847343 to 2846321)