Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3682717
End position: 3682740
Length: 24

DNA sequence
>NC_016804, from 3682717 to 3682740 (24 bp); Mycobacterium bovis BCG str. Mexico GCGCTGGCGGTGGCGCGGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3682412-3684124	Sequence	BCGMEX_3395 - putative transposase fusion protein