Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3878180
End position: 3878203
Length: 24

DNA sequence
>NC_016804, from 3878180 to 3878203 (24 bp); Mycobacterium bovis BCG str. Mexico CCCGACCGCGACCCCGACCCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3878082-3878924	Sequence	BCGMEX_3562c yrbE4B putative integral membrane protein (Protein is coded in complementary strand; from 3878924 to 3878082)