Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 891394
End position: 891417
Length: 24

DNA sequence
>NC_016804, from 891394 to 891417 (24 bp); Mycobacterium bovis BCG str. Mexico GCGCTGGCGGTGGCGCGGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 891089-892183	Sequence	BCGMEX_0820 - putative transposase for insertion sequence element IS1547