Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 982323
End position: 982346
Length: 24

DNA sequence
>NC_016804, from 982323 to 982346 (24 bp); Mycobacterium bovis BCG str. Mexico CGTCGACGTCGTCGACGAAGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 982160-983290	Sequence	BCGMEX_0907c serC phosphoserine aminotransferase (Protein is coded in complementary strand; from 983290 to 982160)