Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3735025
End position: 3735049
Length: 25

DNA sequence
>NC_016804, from 3735025 to 3735049 (25 bp); Mycobacterium bovis BCG str. Mexico GCCGCGCCGGACCGCGCCGGGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3734266-3735060	Sequence	BCGMEX_3421c - putative oxidoreductase (Protein is coded in complementary strand; from 3735060 to 3734266)