Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1190504
End position: 1190530
Length: 27

DNA sequence
>NC_016804, from 1190504 to 1190530 (27 bp); Mycobacterium bovis BCG str. Mexico CACCGCCGACGCCGCCGACACCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1189186-1191201	Sequence	BCGMEX_1097c PE_PGRS19 PE-PGRS family protein (Protein is coded in complementary strand; from 1191201 to 1189186)