Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1193021
End position: 1193047
Length: 27

DNA sequence
>NC_016804, from 1193021 to 1193047 (27 bp); Mycobacterium bovis BCG str. Mexico TCCGCCGGCCCCGCCGGCACCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1191534-1193726	Sequence	BCGMEX_1098c - PE-PGRS family protein (Protein is coded in complementary strand; from 1193726 to 1191534)