Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1385331
End position: 1385357
Length: 27

DNA sequence
>NC_016804, from 1385331 to 1385357 (27 bp); Mycobacterium bovis BCG str. Mexico GCCCCCGTCGCCCCCGACGCCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1384990-1386678	Sequence	BCGMEX_1275c PE_PGRS23 PE PGRS family protein (Protein is coded in complementary strand; from 1386678 to 1384990)