Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1485112
End position: 1485138
Length: 27

DNA sequence
>NC_016804, from 1485112 to 1485138 (27 bp); Mycobacterium bovis BCG str. Mexico GCGCCGCCGGCGCCGCCGTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1484947-1486758	Sequence	BCGMEX_1359c PE_PGRS24 PE-PGRS family protein (Protein is coded in complementary strand; from 1486758 to 1484947)