Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1531941
End position: 1531967
Length: 27

DNA sequence
>NC_016804, from 1531941 to 1531967 (27 bp); Mycobacterium bovis BCG str. Mexico CCTCATAGTCGTCATAGTCGTCATAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1531400-1532185	Sequence	BCGMEX_1397c - hypothetical protein (Protein is coded in complementary strand; from 1532185 to 1531400)