Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1651072
End position: 1651098
Length: 27

DNA sequence
>NC_016804, from 1651072 to 1651098 (27 bp); Mycobacterium bovis BCG str. Mexico CGTTGCCACCGTTGCCGCCGTTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1650960-1652072	Sequence	BCGMEX_1501c PE_PGRS29 PE-PGRS family protein (Protein is coded in complementary strand; from 1652072 to 1650960)