Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1972622
End position: 1972648
Length: 27

DNA sequence
>NC_016804, from 1972622 to 1972648 (27 bp); Mycobacterium bovis BCG str. Mexico CCCGCCGGCACCGCCGGCCCCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1970640-1973048	Sequence	BCGMEX_1771c wag22b PE-PGRS family protein (second part) (Protein is coded in complementary strand; from 1973048 to 1970640)