Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2041626
End position: 2041652
Length: 27

DNA sequence
>NC_016804, from 2041626 to 2041652 (27 bp); Mycobacterium bovis BCG str. Mexico CCGGCGTTGCCGCCGTTGCCGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2041545-2043050	Sequence	BCGMEX_1834c PE_PGRS33 PE-PGRS family protein (Protein is coded in complementary strand; from 2043050 to 2041545)