Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2069409
End position: 2069435
Length: 27

DNA sequence
>NC_016804, from 2069409 to 2069435 (27 bp); Mycobacterium bovis BCG str. Mexico CCGCCGTTGCCGCCGTTGCCGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2069019-2069837	Sequence	BCGMEX_1857c PE_PGRS34a PE-PGRS family protein (Protein is coded in complementary strand; from 2069837 to 2069019)