Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2383072
End position: 2383098
Length: 27

DNA sequence
>NC_016804, from 2383072 to 2383098 (27 bp); Mycobacterium bovis BCG str. Mexico CCACCGGCCCCACCGGCGCCGCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2382619-2384091	Sequence	BCGMEX_2166c PE_PGRS38 PE-PGRS family protein (Protein is coded in complementary strand; from 2384091 to 2382619)