Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2494467
End position: 2494493
Length: 27

DNA sequence
>NC_016804, from 2494467 to 2494493 (27 bp); Mycobacterium bovis BCG str. Mexico ATCGGTGGGATCGGCGGGATCGGTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2494389-2496167	Sequence	BCGMEX_2269c - hypothetical protein (Protein is coded in complementary strand; from 2496167 to 2494389)