Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2722290
End position: 2722316
Length: 27

DNA sequence
>NC_016804, from 2722290 to 2722316 (27 bp); Mycobacterium bovis BCG str. Mexico CGTCGATGTCGGCGATGTCGGCGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2721923-2726794	Sequence	BCGMEX_2487c gdh putative NAD-dependent glutamate dehydrogenase (Protein is coded in complementary strand; from 2726794 to 2721923)