Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2739616
End position: 2739642
Length: 27

DNA sequence
>NC_016804, from 2739616 to 2739642 (27 bp); Mycobacterium bovis BCG str. Mexico CCGCCGTCGCCGCCGTTGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2738974-2740557	Sequence	BCGMEX_2497c PE_PGRS42ab PE-PGRS family protein (Protein is coded in complementary strand; from 2740557 to 2738974)