Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2746660
End position: 2746686
Length: 27

DNA sequence
>NC_016804, from 2746660 to 2746686 (27 bp); Mycobacterium bovis BCG str. Mexico GTCACCGCCGTCACCGCCGTCCCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2744426-2747878	Sequence	BCGMEX_2500c PE_PGRS43b PE-PGRS family protein (Protein is coded in complementary strand; from 2747878 to 2744426)