Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2888101
End position: 2888127
Length: 27

DNA sequence
>NC_016804, from 2888101 to 2888127 (27 bp); Mycobacterium bovis BCG str. Mexico CCGGCCCCGCCGGTCCCGCCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2887411-2888580	Sequence	BCGMEX_2633c PE_PGRS45b PE-PGRS family protein (Protein is coded in complementary strand; from 2888580 to 2887411)