Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2904496
End position: 2904522
Length: 27

DNA sequence
>NC_016804, from 2904496 to 2904522 (27 bp); Mycobacterium bovis BCG str. Mexico ATACCGCCGGTACCGCCGACACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2903914-2906316	Sequence	BCGMEX_2654c PE_PGRS46 PE-PGRS family protein (Protein is coded in complementary strand; from 2906316 to 2903914)