Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2994364
End position: 2994390
Length: 27

DNA sequence
>NC_016804, from 2994364 to 2994390 (27 bp); Mycobacterium bovis BCG str. Mexico TCGAAGTCCGCGAAGTCCTCGAAGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2992669-2995320	Sequence	BCGMEX_2757c ftsK putative cell division transmembrane protein (Protein is coded in complementary strand; from 2995320 to 2992669)