Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 336579
End position: 336605
Length: 27

DNA sequence
>NC_016804, from 336579 to 336605 (27 bp); Mycobacterium bovis BCG str. Mexico CCGCCGGCCCCGCCGTCCCCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 334881-337580	Sequence	BCGMEX_0288c PE_PGRS3 PE-PGRS family protein (Protein is coded in complementary strand; from 337580 to 334881)