Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 337945
End position: 337971
Length: 27

DNA sequence
>NC_016804, from 337945 to 337971 (27 bp); Mycobacterium bovis BCG str. Mexico CGTTGCCGCCGGTGCCGCCGGTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 337830-340334	Sequence	BCGMEX_0289c PE_PGRS4 PE-PGRS family protein (Protein is coded in complementary strand; from 340334 to 337830)