Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3707331
End position: 3707357
Length: 27

DNA sequence
>NC_016804, from 3707331 to 3707357 (27 bp); Mycobacterium bovis BCG str. Mexico TGGCGCCGTTGCCGCCGTTGCCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3704078-3709708	Sequence	BCGMEX_3412c PE_PGRS50 hypothetical protein (Protein is coded in complementary strand; from 3709708 to 3704078)