Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3819655
End position: 3819681
Length: 27

DNA sequence
>NC_016804, from 3819655 to 3819681 (27 bp); Mycobacterium bovis BCG str. Mexico GGCAAGCCCGGCAAGCCCGGCAAACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3819197-3820600	Sequence	BCGMEX_3503c - hypothetical protein (Protein is coded in complementary strand; from 3820600 to 3819197)