Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3990033
End position: 3990059
Length: 27

DNA sequence
>NC_016804, from 3990033 to 3990059 (27 bp); Mycobacterium bovis BCG str. Mexico CACCCCCGACACCGCCGACACCCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3989657-3991411	Sequence	BCGMEX_3653c PE_PGRS58 PE-PGRS family protein (Protein is coded in complementary strand; from 3991411 to 3989657)