Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3994987
End position: 3995013
Length: 27

DNA sequence
>NC_016804, from 3994987 to 3995013 (27 bp); Mycobacterium bovis BCG str. Mexico CCGGGCTGGCCCGGCTGGCCGGGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3994851-3996329	Sequence	BCGMEX_3658c PE_PGRS59 PE PGRS family protein (Protein is coded in complementary strand; from 3996329 to 3994851)