Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 4113477
End position: 4113503
Length: 27

DNA sequence
>NC_016804, from 4113477 to 4113503 (27 bp); Mycobacterium bovis BCG str. Mexico ACCCGGCATACCCGGCATACCCGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4113445-4113846	Sequence	BCGMEX_3777c - hypothetical protein (Protein is coded in complementary strand; from 4113846 to 4113445)