Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 676344
End position: 676370
Length: 27

DNA sequence
>NC_016804, from 676344 to 676370 (27 bp); Mycobacterium bovis BCG str. Mexico ACCCCGCCGGCCCCGCCGGCCCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 673221-677132	Sequence	BCGMEX_0594c PE_PGRS7 PE-PGRS family protein (Protein is coded in complementary strand; from 677132 to 673221)