Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 969369
End position: 969395
Length: 27

DNA sequence
>NC_016804, from 969369 to 969395 (27 bp); Mycobacterium bovis BCG str. Mexico GCCGCCGTTGCCGCCGTTGCCGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 969154-970983	Sequence	BCGMEX_0895c PE_PGRS15 PE PGRS family protein (Protein is coded in complementary strand; from 970983 to 969154)