Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2634024
End position: 2634051
Length: 28

DNA sequence
>NC_016804, from 2634024 to 2634051 (28 bp); Mycobacterium bovis BCG str. Mexico GCGCGGTGCGCTGTACGCGGTGCTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2632451-2634382	Sequence	BCGMEX_2398 ggtB putative gamma-glutamyltranspeptidase