Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2317975
End position: 2318004
Length: 30

DNA sequence
>NC_016804, from 2317975 to 2318004 (30 bp); Mycobacterium bovis BCG str. Mexico CCGCCGTCGCCGCCGCCGCCGCCATCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2317549-2319024	Sequence	BCGMEX_2102c PE_PGRS36 PE-PGRS family protein (Protein is coded in complementary strand; from 2319024 to 2317549)