Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2652876
End position: 2652905
Length: 30

DNA sequence
>NC_016804, from 2652876 to 2652905 (30 bp); Mycobacterium bovis BCG str. Mexico TGCTGTTGTTGTTGCTGCTGCTGTTGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2652864-2654519	Sequence	BCGMEX_2417c - hypothetical protein (Protein is coded in complementary strand; from 2654519 to 2652864)