Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3705219
End position: 3705248
Length: 30

DNA sequence
>NC_016804, from 3705219 to 3705248 (30 bp); Mycobacterium bovis BCG str. Mexico CGCCGCTGCCGCCGGCGCCGCCGTGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3704078-3709708	Sequence	BCGMEX_3412c PE_PGRS50 hypothetical protein (Protein is coded in complementary strand; from 3709708 to 3704078)