Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3776098
End position: 3776127
Length: 30

DNA sequence
>NC_016804, from 3776098 to 3776127 (30 bp); Mycobacterium bovis BCG str. Mexico CCCGGCCCGGCCCGGACAGGCTCGGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3775071-3776654	Sequence	BCGMEX_3461c - hypothetical protein (Protein is coded in complementary strand; from 3776654 to 3775071)