Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 1613715
End position: 1613750
Length: 36

DNA sequence
>NC_016804, from 1613715 to 1613750 (36 bp); Mycobacterium bovis BCG str. Mexico GCCGGCGCCGCCGTCGCCGCCGGCGCCGCCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1613296-1614771	Sequence	BCGMEX_1474c PE_PGRS26 PE-PGRS family protein (Protein is coded in complementary strand; from 1614771 to 1613296)