Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2346990
End position: 2347025
Length: 36

DNA sequence
>NC_016804, from 2346990 to 2347025 (36 bp); Mycobacterium bovis BCG str. Mexico CCCGCCGGCCCCGCCAGCCCCGCCCGCGCCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2346577-2347347	Sequence	BCGMEX_2128c PE_PGRS37 PE PGRS family protein (Protein is coded in complementary strand; from 2347347 to 2346577)