Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 2560614
End position: 2560649
Length: 36

DNA sequence
>NC_016804, from 2560614 to 2560649 (36 bp); Mycobacterium bovis BCG str. Mexico ATCAGTGCCAACAGTGCCAACAGTGCCAACAGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2560155-2560682	Sequence	BCGMEX_2340c lppP putative lipoprotein (Protein is coded in complementary strand; from 2560682 to 2560155)