Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 333846
End position: 333881
Length: 36

DNA sequence
>NC_016804, from 333846 to 333881 (36 bp); Mycobacterium bovis BCG str. Mexico CCCGCCGGCCCCGCCCGCACCGCCGGCCCCGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 331867-334617	Sequence	BCGMEX_0287c PE_PGRS3a PE-PGRS family protein (Protein is coded in complementary strand; from 334617 to 331867)