Sequence retrieval

Genome: Mycobacterium bovis BCG str. Mexico
Start position: 3837829
End position: 3837864
Length: 36

DNA sequence
>NC_016804, from 3837829 to 3837864 (36 bp); Mycobacterium bovis BCG str. Mexico TCGGGGGCCTCTGCGGGGGGCTCTTCGGGGGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3837823-3838365	Sequence	BCGMEX_3519c rplQ 50S ribosomal protein L17 (Protein is coded in complementary strand; from 3838365 to 3837823)